ID: 1162337510_1162337520

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1162337510 1162337520
Species Human (GRCh38) Human (GRCh38)
Location 19:10070978-10071000 19:10071017-10071039
Sequence CCAGCTCTCCCATGAGAAGAACA GGTTCACAGGATGCTGCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 190} {0: 1, 1: 0, 2: 3, 3: 18, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!