ID: 1162341653_1162341660

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1162341653 1162341660
Species Human (GRCh38) Human (GRCh38)
Location 19:10094890-10094912 19:10094907-10094929
Sequence CCACAAGACGGACCGGAACCACA ACCACAGGCACCAGTGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42} {0: 1, 1: 0, 2: 3, 3: 21, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!