ID: 1162342987_1162342995

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1162342987 1162342995
Species Human (GRCh38) Human (GRCh38)
Location 19:10102927-10102949 19:10102965-10102987
Sequence CCCTGGGGCAGCCAGGCGTGATC CACACACCACACATAGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 136} {0: 1, 1: 0, 2: 3, 3: 18, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!