ID: 1162343539_1162343550

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1162343539 1162343550
Species Human (GRCh38) Human (GRCh38)
Location 19:10106520-10106542 19:10106570-10106592
Sequence CCCGCGCCCAGGCGCAGCTCCGC CACTCGTTCGTGTTCACGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 285} {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!