ID: 1162381235_1162381250

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1162381235 1162381250
Species Human (GRCh38) Human (GRCh38)
Location 19:10333181-10333203 19:10333228-10333250
Sequence CCCCCGCCAACGACCCCCGCGCA CCCCCCGCGCACGCGCACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95} {0: 1, 1: 1, 2: 1, 3: 15, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!