ID: 1162382344_1162382349

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1162382344 1162382349
Species Human (GRCh38) Human (GRCh38)
Location 19:10339027-10339049 19:10339047-10339069
Sequence CCTCTCTCCTTGTGCCGAGACAG CAGAAGGGTTCCTGCCTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126} {0: 1, 1: 1, 2: 4, 3: 39, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!