ID: 1162386297_1162386308

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1162386297 1162386308
Species Human (GRCh38) Human (GRCh38)
Location 19:10362248-10362270 19:10362292-10362314
Sequence CCCCCTATCATCGTACCTCCTGG CAGAGAGAAGCAGTCATCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69} {0: 1, 1: 0, 2: 2, 3: 36, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!