ID: 1162399170_1162399178

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1162399170 1162399178
Species Human (GRCh38) Human (GRCh38)
Location 19:10434358-10434380 19:10434397-10434419
Sequence CCATAGCCCAGCTAATTTTTTTG GGGGTTTCTCTATGGTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 92, 3: 479, 4: 1951} {0: 1, 1: 144, 2: 9897, 3: 109271, 4: 213899}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!