ID: 1162407815_1162407830

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1162407815 1162407830
Species Human (GRCh38) Human (GRCh38)
Location 19:10486246-10486268 19:10486285-10486307
Sequence CCCTGGGAACCACATTTCCAGAG GCCCCCATTGGCCCCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 212} {0: 1, 1: 0, 2: 0, 3: 30, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!