ID: 1162412936_1162412949

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1162412936 1162412949
Species Human (GRCh38) Human (GRCh38)
Location 19:10517421-10517443 19:10517461-10517483
Sequence CCGCAGTCGCGCTGCCTTGAACC TCCGGGGGCGGGGCTGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54} {0: 1, 1: 1, 2: 15, 3: 120, 4: 1056}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!