ID: 1162412939_1162412957

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1162412939 1162412957
Species Human (GRCh38) Human (GRCh38)
Location 19:10517442-10517464 19:10517477-10517499
Sequence CCGAGTGAGCGGACGCCGCTCCG GAGCTGGCAGGCGAGGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20} {0: 1, 1: 1, 2: 8, 3: 76, 4: 774}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!