ID: 1162416878_1162416895

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1162416878 1162416895
Species Human (GRCh38) Human (GRCh38)
Location 19:10543809-10543831 19:10543842-10543864
Sequence CCGCCTGGCGACCCGGGATCGGG CGGCTGGGCGGGGAGAGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 62} {0: 1, 1: 1, 2: 15, 3: 131, 4: 1022}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!