ID: 1162422352_1162422362

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1162422352 1162422362
Species Human (GRCh38) Human (GRCh38)
Location 19:10573047-10573069 19:10573089-10573111
Sequence CCCCCATCTCTTCTCCCTTCTAG CTGCAGAGAAAGAATGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 121, 4: 1374} {0: 1, 1: 0, 2: 2, 3: 67, 4: 707}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!