ID: 1162423499_1162423502

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1162423499 1162423502
Species Human (GRCh38) Human (GRCh38)
Location 19:10579803-10579825 19:10579852-10579874
Sequence CCGCACGCACTGGTGGAATTTTA TTGCTGCCTGAAACTCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 82} {0: 1, 1: 0, 2: 0, 3: 20, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!