ID: 1162432332_1162432348

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1162432332 1162432348
Species Human (GRCh38) Human (GRCh38)
Location 19:10636522-10636544 19:10636572-10636594
Sequence CCCTGCGCAAGCCGGACGACCTG GGCCGGGCGCTCAGGTGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32} {0: 1, 1: 0, 2: 1, 3: 34, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!