|
Left Crispr |
Right Crispr |
Crispr ID |
1162441337 |
1162441342 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
19:10694142-10694164
|
19:10694189-10694211
|
Sequence |
CCTTGCTGGCCAGGCTGGTCTCA |
GTCTTGGCCTCCCAAAGTGCTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 3058, 1: 63262, 2: 176853, 3: 220638, 4: 171177} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|