ID: 1162441340_1162441342

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1162441340 1162441342
Species Human (GRCh38) Human (GRCh38)
Location 19:10694174-10694196 19:10694189-10694211
Sequence CCTCGTGATCCACTCGTCTTGGC GTCTTGGCCTCCCAAAGTGCTGG
Strand - +
Off-target summary No data {0: 3058, 1: 63262, 2: 176853, 3: 220638, 4: 171177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!