ID: 1162442622_1162442630

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1162442622 1162442630
Species Human (GRCh38) Human (GRCh38)
Location 19:10702192-10702214 19:10702233-10702255
Sequence CCTACGACGGCAATGAGACCCTG GTGCAGATCCAGAATGCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 47} {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!