ID: 1162445108_1162445117

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1162445108 1162445117
Species Human (GRCh38) Human (GRCh38)
Location 19:10718138-10718160 19:10718176-10718198
Sequence CCGGGCGGGCGGGGAGCAACGGC GCCAGGTCGTTGAGGGTCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 132} {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!