ID: 1162446151_1162446155

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1162446151 1162446155
Species Human (GRCh38) Human (GRCh38)
Location 19:10724056-10724078 19:10724101-10724123
Sequence CCTGGGCGGAAGAACGAGACCTC CGATAAGTATGATGGAAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 167, 4: 3280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!