ID: 1162485992_1162486002

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1162485992 1162486002
Species Human (GRCh38) Human (GRCh38)
Location 19:10960956-10960978 19:10960988-10961010
Sequence CCGGCGAGCGCGCGCGCAGCGGG GGCGCGCGTGTGTGTGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 160} {0: 1, 1: 0, 2: 1, 3: 24, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!