ID: 1162486140_1162486148

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1162486140 1162486148
Species Human (GRCh38) Human (GRCh38)
Location 19:10961433-10961455 19:10961467-10961489
Sequence CCTCTCCGCGCGCGCTCTCGCCG CAAAGCTCGCCCCCCTCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 149} {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!