|
Left Crispr |
Right Crispr |
| Crispr ID |
1162506569 |
1162506579 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:11089580-11089602
|
19:11089610-11089632
|
| Sequence |
CCGTCGCCTTGCTCCTCGCCGCG |
CTGCAGGTAAGGCTTGCTCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 10, 4: 109} |
{0: 1, 1: 0, 2: 5, 3: 26, 4: 280} |
| Status |
Complete |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.