ID: 1162517214_1162517219

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1162517214 1162517219
Species Human (GRCh38) Human (GRCh38)
Location 19:11155668-11155690 19:11155692-11155714
Sequence CCTGCTCGTGGCGCCCCAGCAGC GTCGCTGCTGCGCCTCCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 1, 3: 22, 4: 257} {0: 1, 1: 0, 2: 1, 3: 3, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!