ID: 1162520109_1162520116

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1162520109 1162520116
Species Human (GRCh38) Human (GRCh38)
Location 19:11174650-11174672 19:11174689-11174711
Sequence CCAGGCGCAGCCACTCCTGCAGC CTTTCTGCATGCGAGTCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 528} {0: 1, 1: 0, 2: 0, 3: 2, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!