ID: 1162525153_1162525161

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1162525153 1162525161
Species Human (GRCh38) Human (GRCh38)
Location 19:11202536-11202558 19:11202555-11202577
Sequence CCCAAGGCAGCCCCATGCCCCGT CCGTTCCACCCCCAACCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 238} {0: 1, 1: 0, 2: 2, 3: 9, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!