ID: 1162543100_1162543109

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1162543100 1162543109
Species Human (GRCh38) Human (GRCh38)
Location 19:11310177-11310199 19:11310223-11310245
Sequence CCAGAGGTGAGATGTGCCAGGGG AAGTGCAGGAAGAAGGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 21, 3: 157, 4: 1261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!