ID: 1162551725_1162551729

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1162551725 1162551729
Species Human (GRCh38) Human (GRCh38)
Location 19:11361824-11361846 19:11361843-11361865
Sequence CCCCAGGATGCTACAGGCGCTAG CTAGATATTAGCTGGCAGACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!