ID: 1162554966_1162554974

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1162554966 1162554974
Species Human (GRCh38) Human (GRCh38)
Location 19:11381156-11381178 19:11381192-11381214
Sequence CCGGCCCCGCAGGTTGCTCAGCA GCCCTCCAGGATCTCCACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 188} {0: 1, 1: 0, 2: 3, 3: 18, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!