ID: 1162562295_1162562310

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1162562295 1162562310
Species Human (GRCh38) Human (GRCh38)
Location 19:11423763-11423785 19:11423815-11423837
Sequence CCGACCTGGCAGAGAGGGGAGAC CCCCTGGGGCCCGTCTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 370} {0: 1, 1: 0, 2: 2, 3: 41, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!