ID: 1162573174_1162573192

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1162573174 1162573192
Species Human (GRCh38) Human (GRCh38)
Location 19:11483997-11484019 19:11484043-11484065
Sequence CCTCCCACCCAATCCTCTAGCGG GCAGGGGGGTCTCGCCGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 146} {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!