ID: 1162665732_1162665737

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1162665732 1162665737
Species Human (GRCh38) Human (GRCh38)
Location 19:12210218-12210240 19:12210257-12210279
Sequence CCAGGTTCAAGCGATTCTCCTTG CAGGTGCCCGCCACCACGCCCGG
Strand - +
Off-target summary {0: 79, 1: 1105, 2: 49270, 3: 125166, 4: 151998} {0: 3715, 1: 23283, 2: 55735, 3: 78440, 4: 119144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!