ID: 1162718535_1162718545

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1162718535 1162718545
Species Human (GRCh38) Human (GRCh38)
Location 19:12648334-12648356 19:12648375-12648397
Sequence CCCCGACCCGTTCTCCATTAGTG CATCGTCCTTCAGCAGCCTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38} {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!