ID: 1162718535_1162718550

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1162718535 1162718550
Species Human (GRCh38) Human (GRCh38)
Location 19:12648334-12648356 19:12648387-12648409
Sequence CCCCGACCCGTTCTCCATTAGTG GCAGCCTTCGGTGCACCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38} {0: 1, 1: 0, 2: 1, 3: 11, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!