ID: 1162718536_1162718547

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1162718536 1162718547
Species Human (GRCh38) Human (GRCh38)
Location 19:12648335-12648357 19:12648384-12648406
Sequence CCCGACCCGTTCTCCATTAGTGG TCAGCAGCCTTCGGTGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51} {0: 1, 1: 0, 2: 1, 3: 11, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!