ID: 1162720349_1162720353

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1162720349 1162720353
Species Human (GRCh38) Human (GRCh38)
Location 19:12658265-12658287 19:12658280-12658302
Sequence CCGGCCGACTGGAAAAGTAACCG AGTAACCGGTCCAGAACTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18} {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!