ID: 1162738956_1162738973

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1162738956 1162738973
Species Human (GRCh38) Human (GRCh38)
Location 19:12763125-12763147 19:12763178-12763200
Sequence CCTCCCGCCCTCCCTCCCCACCA CCTCAAAGCTCTCGAGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 47, 3: 606, 4: 10829} {0: 1, 1: 0, 2: 1, 3: 4, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!