ID: 1162753578_1162753594

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1162753578 1162753594
Species Human (GRCh38) Human (GRCh38)
Location 19:12843657-12843679 19:12843703-12843725
Sequence CCCTCCAGCCTGAAGACCCACAC CTTGATGACAGTTTAGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 43, 4: 308} {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!