ID: 1162755772_1162755783

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1162755772 1162755783
Species Human (GRCh38) Human (GRCh38)
Location 19:12858708-12858730 19:12858750-12858772
Sequence CCACCTCTGCATGGTCATGGAAT CTGCGGGGCTGCAGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 239} {0: 1, 1: 1, 2: 6, 3: 67, 4: 552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!