ID: 1162760422_1162760430

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1162760422 1162760430
Species Human (GRCh38) Human (GRCh38)
Location 19:12885559-12885581 19:12885587-12885609
Sequence CCCTGGAGCCCGCGGAAGAGCTG GCCCTTGGTACTGAGGCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149} {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!