ID: 1162797792_1162797814

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1162797792 1162797814
Species Human (GRCh38) Human (GRCh38)
Location 19:13095588-13095610 19:13095639-13095661
Sequence CCCATCAGTTCCTGCCCCTGCCC GCCGGAGGGTGGAGCAGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 495} {0: 1, 1: 0, 2: 4, 3: 40, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!