ID: 1162799473_1162799481

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1162799473 1162799481
Species Human (GRCh38) Human (GRCh38)
Location 19:13102901-13102923 19:13102940-13102962
Sequence CCGGAGGAAACCAGCGGGCGGGG CTCCCGGCCCCGCCCCCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99} {0: 1, 1: 2, 2: 18, 3: 120, 4: 708}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!