ID: 1162801409_1162801422

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1162801409 1162801422
Species Human (GRCh38) Human (GRCh38)
Location 19:13112765-13112787 19:13112813-13112835
Sequence CCCGCTGTTCCCCGCCAACACCG CAACCCTGCAGAGAGGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124} {0: 1, 1: 0, 2: 4, 3: 29, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!