ID: 1162805522_1162805532

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1162805522 1162805532
Species Human (GRCh38) Human (GRCh38)
Location 19:13136200-13136222 19:13136239-13136261
Sequence CCTGCCACTCGCGTGCCACTCTC GGTGGAGGCCCTCCCGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 102} {0: 1, 1: 0, 2: 0, 3: 26, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!