ID: 1162833867_1162833878

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1162833867 1162833878
Species Human (GRCh38) Human (GRCh38)
Location 19:13303495-13303517 19:13303546-13303568
Sequence CCATGGGCAGGTGGTAACTTTGC CTTGGTGAGCTCCTGGGCGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123} {0: 1, 1: 0, 2: 6, 3: 21, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!