ID: 1162843375_1162843379

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1162843375 1162843379
Species Human (GRCh38) Human (GRCh38)
Location 19:13372523-13372545 19:13372546-13372568
Sequence CCAGCCTGCATGGGTTCAGATCC CAGATCTGCCACTTTCCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 23, 3: 186, 4: 658} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!