ID: 1162860991_1162860999

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1162860991 1162860999
Species Human (GRCh38) Human (GRCh38)
Location 19:13505836-13505858 19:13505853-13505875
Sequence CCATCAACCCCCGGGTCTCTCTC TCTCTCCCAGCCTGGAAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 196} {0: 1, 1: 0, 2: 3, 3: 37, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!