ID: 1162860991_1162861003

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1162860991 1162861003
Species Human (GRCh38) Human (GRCh38)
Location 19:13505836-13505858 19:13505859-13505881
Sequence CCATCAACCCCCGGGTCTCTCTC CCAGCCTGGAAGAGGGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 196} {0: 1, 1: 2, 2: 8, 3: 88, 4: 699}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!