ID: 1162873000_1162873008

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1162873000 1162873008
Species Human (GRCh38) Human (GRCh38)
Location 19:13599999-13600021 19:13600030-13600052
Sequence CCACGGGCCTCGCTCAGAAATCC TCTCCCTCCAGCACAGTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122} {0: 1, 1: 0, 2: 1, 3: 23, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!