ID: 1162883210_1162883214

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1162883210 1162883214
Species Human (GRCh38) Human (GRCh38)
Location 19:13676069-13676091 19:13676112-13676134
Sequence CCTTCCAGTGTCTGCAGATACTG GTAGTCATGAGAGAAATGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!